Кой е по-по-най: имунитетът срещу COVID-19 е различен при боледуване и след ваксиниране

Кой е по-по-най: имунитетът срещу COVID-19 е различен при боледуване и след ваксиниране

© Associated Press

Едва за около 4% от населението на България може да се смята, че има имунитет срещу COVID-19. Резултатът се получава като към преболедувалите от началото на епидемията (около 203 хил. души) се прибавят ваксинираните с втора доза (около 35 хил. души) и се изчисли процентното им съотношение към населението на страната (по данни на Националния статистически институт малко под 7 млн. души).

Това означава, че страната е твърде далеч от етапа на защита от инфекциозното заболяване и забавяне на разпространението му - смята се, че за постигане на колективен имунитет е необходимо поне 60% от населението да бъде преболедувало или ваксинирано срещу COVID-19. "Дневник" се допита до специалисти какви са разликите в имунитета, придобит след боледуване и от ваксиниране.

Всички говорят за антитела

"Антитела" е сред думите, които са неразделна част от COVID речника на всеки интересувал се от епидемията. След преболедуване масово хората си правят кръвни изследвания за антитела, защото образуването им се смята за изградена защита на организма. Това е вярно, но е твърде общо съждение.

Имунологът д-р Цветелина Великова прави сравнение между имунитета от преболедуване на COVID-19 и след ваксиниране, като един от аспектите, за които обобщава научна информация, са антителата. Тя обяснява, че след преминаване през инфекцията само някои от образуваните антитела неутрализират вируса, а и при пациентите с леки или никакви симптоми антителата не са в достатъчно количество и качество.

За разлика от това, образуваните антитела след ваксиниране срещу COVID-19 са "вирус-неутрализиращи антитела от различни имуноглобулинови класове" и са насочени специфично срещу т. нар. spike protein (шипчест протеин), с който вируса навлиза в човешките клетки.

"Много важно е да се наблегне, че антителата са важни при вирусни инфекции, но те не са единственото парче от пъзела с имунитета", заключва д-р Великова в друга своя публикация за имунитета срещу COVID-19.

Инфекцията се случва в клетките

Имунологът обяснява, че с тестовете за антитела, които търсят количествата им в човешкото тяло, не се изследват други важни показатели за имунитета срещу COVID-19.

"При вирусните инфекции не само антителата играят роля за защитата на организма, тъй като вирусите инфектират клетките, като влизат в тях. Антителата имат малко поле за изява - те могат да реагират на вируса само докато той е извън клетките. Реално инфекцията се случва в клетките, които са заразени, а антителата остават навън - в кръвообращението или в тъканите", обясни за "Дневник" д-р Цветелина Великова.

По думите ѝ на клетъчно ниво изключително голяма роля играят:

- T-лимфоцитите, които убиват заразени клетки
- B-лимфоцитите, които разпознават вирусните частици и започват да произвеждат антитела
- Клетките-естествени убийци на вродената имунна система

"Когато имаме естествена инфекция, различни антигени на вируса се представят на имунната система и тя създава отговор срещу тях. По този начин имунната система се разпилява, тъй като в началото не може да прецени кои антитела и имунни клетки ще се ефективни срещу вируса. Тя създава имунитет срещу всички антигени и след това във времето остават тези антитела и клетки, които са ефективни, за да защитят организма", казва д-р Великова за имунитета след заразяване.

Тя обяснява, че при ваксиниране "подаваме само един антиген, срещу който имунната система реагира и имаме имунни клетки, които разпознават и се активират, съответно имаме и антитела само срещу него. Така създаваме насочен имунен отговор".

По думите ѝ ваксините са създадени на база на данните от естественото преболедуване, като учените са установили срещу кои части на вируса е най-ефективен имунитетът. "Затова е избран spike протеинът да бъде съставна част на всичките ваксини - срещу него имунитетът е ефективен и антителата са вирусонеутрализиращи", казва д-р Великова.

И преболедувалите да се ваксинират

"Има данни, че вирусът потиска имунната система, когато взаимодейства с нея, т.е. никога не знам дали при една естествена инфекция имунитетът ще даде достатъчно защита и за колко време от повторна инфекция", смята д-р Великова. Тя обяснява, че за разлика от това, при изпитванията на ваксините срещу COVID-19 са правени анализи на количеството и качеството на антителата.

"Само по наличието на антитела не можем да сме сигурни колко е качествен имунитетът, докато при ваксините, тъй като там няма потискане на имунитета, знаем, че имунният отговор се е развил оптимално", обяснява специалистът.

В интервю за "Дневник" Велислава Петрова, доктор по инфекциозни болести и имунология, обясни, че при естествена инфекция имунната система вижда само най-повърхностната част на spike протеина, докато ваксината дава информация за представяне на цялата му част.

При взимането на решение на преболедувалите за ваксиниране срещу COVID-19 Велислава Петрова се позовава на препоръка на Световната здравна организация (СЗО). Според нея, ако не са в рискова група (напр. лекари или възрастни над 65 годишна възраст), преболедувалите могат да отложат ваксинирането с около шест месеца, за да дадат предимство на тези, които не са минали през инфекцията.

И колективният имунитет

Колективният имунитет се счита като сбор на преболедувалите и ваксинираните хора. Специалистите постоянно акцентират, че обществото не бива да се стреми към него с естествена инфекция, защото това крие рискове от усложнения и смърт, които не могат да бъдат предвидени.

"При естественото преболедуване се дава възможност на вируса, преминавайки през много индивиди, да мутира в нови варианти, което вече го наблюдаваме", казва д-р Великова, имайки предвид разпространението на британския, южноафриканския и бразилския вариант. Според нея ваксинирането е начин наведнъж голяма част от населението да стане невъзприемчиво към заразата и това да блокира разпространението ѝ.

"Освен това, колективен имунитет е термин, който се използва за характеризиране на имунитет, придобит от ваксина, за да се прецени колко добре е направена една ваксинационна кампания", смята Велислава Петрова.

Всичко, което трябва да знаете за:
Коментари (129)
  1. Подредба: Сортирай
  1. 1 Профил на Бланш
    Рейтинг: 1722 Неутрално

    Трябва да си произведем ваксината, никой няма да ни помогне достатъчно.

  2. 2 Профил на hamiltonf
    Рейтинг: 3897 Весело

    $Имунологът д-р Цветелина Великова прави сравнение между имунитета от преболедуване на COVID-19 и след ваксиниране, като един от аспектите, за които обобщава научна информация, са антителата. Тя обяснява, че след преминаване през инфекцията само някои от образуваните антитела неутрализират вируса, а и при пациентите с леки или никакви симптоми антителата не са в достатъчно количество и качество.
    В интервю за "Дневник" Велислава Петрова, доктор по инфекциозни болести и имунология, обясни, че при естествена инфекция имунната система вижда само най-повърхностната част на spike протеина, докато ваксината дава информация за представяне на цялата му част"

    Това внимателно да се прочете от някои форумни "специалисти"...

    Старши подофицер Сава Геров, Първа пехотна софийска дивизия, герой, за когото се знае твърде малко... Вечна му памет!
  3. 3 Профил на cosmo
    Рейтинг: 487 Неутрално

    Народ, който 4 пъти си избира пожарникар - простак да го управлява и краде, не може да бъде сломен от един вирус.

  4. 4 Профил на Petio Petkov
    Petio Petkov
    Рейтинг: 54 Неутрално

    230 000 са официално преболедувалите. Към тях трябва да се прибавят безсимптомно преболедувалите - 50%, според научни публикации, преболедувалите и нерегистрирани с леки и средно тежки симптоми в къщи (в моето семейство са 8-9 при само 1 регистриран), преболедувалите по селца и паланки, без достъп до нормална медицинска помощ, страхуващите се да влязат в болница - и те не са малко. Общо според наши епидемиолози, включително от НОЩ, преболедувалите са от 1,5 до 2,5 милиона при 5-5,2 милиона души в държавата (без емигрантите). От тази цифра трябва да се тръгва, за да има смисъл от анализа. С погрешни данни и най-добрият експерт няма да направи точни изводи.

  5. 5 Профил на N I K E
    N I K E
    Рейтинг: 400 Неутрално

    Това което цитирате е официалната информация/статистика. В математическите модели се умножават броя на рег.заболели х10 т.к. има много хора които са боледували, но не са тествани съответно регистрирани които имат изградени антитела.

  6. 6 Профил на Николай Бучков
    Николай Бучков
    Рейтинг: 1555 Любопитно

    И кръвната група е важна......

  7. 7 Профил на lz2
    Рейтинг: 1777 Неутрално

    $Имунологът д-р Цветелина Великова прави сравнение между имунитета от преболедуване на COVID-19 и след ваксиниране, като един от аспектите, за които обобщава научна информация, са антителата. Тя обяснява, че след преминаване през инфекцията само някои от образуваните антитела неутрализират вируса, а и при пациентите с леки или никакви симптоми антителата не са в достатъчно количество и качество.В интервю за "Дневник" Велислава Петрова, доктор по инфекциозни болести и имунология, обясни, че при естествена инфекция имунната система вижда само най-повърхностната част на spike протеина, докато ваксината дава информация за представяне на цялата му част"Това внимателно да се прочете от някои форумни "специалисти"...
    —цитат от коментар 2 на hamiltonf

    Ти пък! Те са последна инстанция! От тях няма по-вещи никъде!

    ПравописА е поле за изява на неграмотните!
  8. 8 Профил на Ати
    Рейтинг: 8 Неутрално

    От 9 планини вода ще докараме за убеждаваме за ваксините...трябват поне 5г за да има достоверна статистика...стига пропаганда..

  9. 9 Профил на k_
    Рейтинг: 2680 Неутрално

    Еиии, пак да пропуснали да питат колко време трае защитата от грипните ваксини?
    Имам поставена за жълта треска и си я подновявам всеки 10г.
    А тези?

  10. 10 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    > а и при пациентите с леки или никакви симптоми антителата не са в достатъчно количество и качество.

    Е това ако не е пълна глупост, не знам какво да кажа.

    И изобщо - какво значи 'пациент с леки или никакви симптоми' ?

    Какво му е пациентското ?

  11. 11 Профил на Vαζελιν Αλbιωνοβ
    Vαζελιν Αλbιωνοβ
    Рейтинг: 295 Неутрално

    Абе дайте да нахраним фармацевтичната мафия, че едвам оцелява в кризата, другото няма значение.
    Те горките са в ступор от перспективата да си загубят клиентите над 65 години, които са им поне 80% от приходите.
    А след 200-300 години, когато всякаква следа от генетично унаследена добра имунна система ще е напълно изличена у цялото човечество ( такава се постига за над 200 000 години сериозно боледуване и много, ама много смърт ), всички ще живеем като болни от СПИН, щото и най-малката инфекция ще ни мори.
    Добре, че няма да доживея.

    кравосмешението прави зелката ^¥^
  12. 12 Профил на b.rainstorm
    Рейтинг: 72 Неутрално

    Колкото повече ваксини, толкова по-добре. Но Бойо се мотае, разбира се.

  13. 13 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#3] от "cosmo":

    > Народ, който 4 пъти си избира пожарникар - простак да го управлява и краде,
    > не може да бъде сломен от един вирус.

    Колега вие ме успокоихте.

  14. 14 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#2] от "hamiltonf":

    > докато ваксината дава информация за представяне на цялата му част

    Значи неколкостотин хиляди години, едва сме се крепяли на ръба на съществуването разчитайки на имунната система / теорията на Дарвин.

    Ама последната 1 година са се намерили експерти които могат да свършат същата работа по-добре и да ни спасят.

    'дава информация за представяне на цялата му част' (за вируса) - направо ще си го разпечатам и сложа на стената.

  15. 15 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#2] от "hamiltonf":

    > докато ваксината дава информация за представяне на цялата му част

    Значи неколкостотин хиляди години, едва сме се крепяли на ръба на съществуването разчитайки на имунната система / теорията на Дарвин.

    Ама последната 1 година са се намерили експерти които могат да свършат същата работа по-добре и да ни спасят.

    'дава информация за представяне на цялата му част' (за вируса) - направо ще си го разпечатам и сложа на стената.

  16. 16 Профил на dejmos
    Рейтинг: 2449 Неутрално

    В 7.30 две публикации за КОРОНИТЕ , в стил "вируси се шляят" навън. В къщи ..и никакви избори ,защото там ще се съберат най много КОРОНИ ...Не става ясно ,защо УЖ демократична меди УБИВА избирателната активност на собственият си народ , а може би е ЯСНО !??

  17. 17 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#4] от "Petio Petkov":

    > Общо според наши епидемиолози, включително от НОЩ

    И къде точно в НОЩ има епидемиолози?

    По спомени 'съвета от експерти' не издържа и седмица и се разпусна, и в НОЩ си остана стандартния комплект от бюрократи, пожарникари, военни, счетоводители и псевдо-математици.

  18. 18 Профил на Разобличител
    Рейтинг: 522 Неутрално

    Убеден съм, че ще има друг(и) имунолози, които ще твърдят точно обратното.

    Не участвувайте в безплодните дела на тъмнината; напротив, изобличавайте ги. Защото за онова, което нечестивците скришом вършат, срамно е и да се говори (Еф. 5:11-12).
  19. 19 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#4] от "Petio Petkov":

    Последните епидемолози с които НОЩ е имало нещо общо е било преди 11 месеца.

    АПРИЛ 4, 2020

    Медицинският експертен съвет към Министерски съвет прекратява дейност. Това заяви председателят на органа проф. Коста Костов пред Дарик радио.

    Информацията потвърдиха други членове на съвета.

    Той беше създаден преди две седмици, за да помага на медиците ни в лечението на пациенти с COVID-19. За това време те изготвиха комплексен документ, който да служи за наръчник.

    Причината да спре дейността на съвета от експерти е, че ангажиментите им вече са приключили.

  20. 20 Профил на AModoMio
    Рейтинг: 3061 Неутрално

    Вчера четох за мед. работник починал от Ковид, въпреки, че е получил и двете дози. Обяснението което дават е, че се е заразил след първата доза, когато още не са се образували антитела.

    "Ако ние нямахме взаимоотношения с политиците щяхме да бъдем една банда от чакали. Или една обикновена банда и щяхме да бъдем анулирани." Тото Риина след атентатите
  21. 21 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#20] от "AModoMio":

    Първо - Всички сме заразени. Това в вирус, не е слон.

    Второ - Ваксината не обещава безсмъртие.

  22. 22 Профил на Vαζελιν Αλbιωνοβ
    Vαζελιν Αλbιωνοβ
    Рейтинг: 295 Неутрално

    До коментар [#18] от "Мизийски":

    На тях никой няма да им публикува разсъжденията, защото не носят приходи. В днешно време добрите разсъждения (статии, мнения, анализи) са тези, които носят приходи.

    Гешефтланд юбер алес.

    кравосмешението прави зелката ^¥^
  23. 23 Профил на padrino
    Рейтинг: 4199 Весело

    Народ, който 4 пъти си избира пожарникар - простак да го управлява и краде, не може да бъде сломен от един вирус.
    —цитат от коментар 3 на cosmo

    А скоро и пети път като гледам отдалеч как се развиват нещата😂

    Orgoglioso di essere metà Italiano 🇮🇹 e metà Bulgaro 🇧🇬
  24. 24 Профил на 4ort
    Рейтинг: 1283 Неутрално

    Народ, който 4 пъти си избира пожарникар - простак да го управлява и краде, не може да бъде сломен от един вирус.
    —цитат от коментар 3 на cosmo

    Народ, който очаква комунисти, чалгари и болшевики да го избавят от тежкото пожарникарско робство е обречен.

  25. 25 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#23] от "padrino":

    За съжаление, така е в бостана ...

  26. 26 Профил на padrino
    Рейтинг: 4199 Весело

    До коментар [#20] от "AModoMio":Първо - Всички сме заразени. Това в вирус, не е слон.Второ - Ваксината не обещава безсмъртие.
    —цитат от коментар 21 на Ан Он

    Глупости😂 90% смятат, че като ги боднат и стават безсмъртни и никога вече няма да се разболеят.😂😂😂...останалите 10% които могат да мислят знаят, че ваксините работят за намаляване на ефекта от заразата а не от премахването и... ама хора всякакви🤷‍♂️

    Orgoglioso di essere metà Italiano 🇮🇹 e metà Bulgaro 🇧🇬
  27. 27 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#24] от "4ort":

    > който очаква комунисти, чалгари и болшевики да го избавят от тежкото пожарникарско робство

    А каква точно е разликата между упоменатите четири категории ?

    Баш Науката си е точно толкова и комунист и чалгар и болшевик колкото и конкуренцията.

    Верно е че ги води с една докторска диплома за пожарникар (ама дипломната работа е засекретена)

  28. 28 Профил на cormoranstrike
    Рейтинг: 570 Неутрално

    До коментар [#18] от "Мизийски":

    Затова е коректно, когато се излага едно такова проучване да се посочва кой го плаща :-)

  29. 29 Профил на hope
    Рейтинг: 2910 Неутрално

    Еиии, пак да пропуснали да питат колко време трае защитата от грипните ваксини?Имам поставена за жълта треска и си я подновявам всеки 10г.А тези?
    —цитат от коментар 9 на k_

    Слагаш ваксината и изграждаш антитела, колкото изкарат толкова, въпросът е, че и да се разболееш ще го изкараш леко и няма да развиеш тежки симптоми. Октомври правиш количествен тест за антитела, ако нямаш, слагаш нова.
    Какво ще чакаме статистика, през това време ще озмрат много от нас.. и без това всеки организъм е различен, ако статистиката показва, че снтителата траят средно година, каква ти е гаранцията, че при теб няма да са 6 или 18 месеца? Никаква.

    Любовта ще спаси света!!!
  30. 30 Профил на volarok
    Рейтинг: 2001 Неутрално

    Ясно, трябва да се ваксинираме до второ пришествие. Апропо, тази година покрай пандемията от ковид-19 забравиха за грипа 😜

  31. 31 Профил на uq
    Рейтинг: 2305 Неутрално

    От личен опит мога да кажа, че това са ПЪЛНИ глупости!
    1) Преболедувалите са МНОГО повече от 200 000. Всеки трети когото срещна ми казва че го е изкарал. Поне 2 милиона са
    2) Жена ми го изкара по-леко от мен а има 2 пъти повече антитела. Един колега го изкара тежко с пневмония, болници.. и антителата му бяха на половина на моите.
    Така че тая кака мое се снима! Аз на някакъв недоучен **%лог ли да вярвам, или на очите си?

  32. 32 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#31] от "uq":

    Колега, това че вашия организъм има някакви особености... са си особености на вашия организъм.

    Трябва да имаме доверие на Науката. Само тя може да ни Спаси в тези Смутни Времена.

  33. 33 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#31] от "uq":

    Колега, това че вашия организъм има някакви особености... са си особености на вашия организъм.

    Трябва да имаме доверие на Науката. Само тя може да ни Спаси в тези Смутни Времена.

  34. 34 Профил на Умнокрасив гербераст от Позитано
    Умнокрасив гербераст от Позитано
    Рейтинг: 914 Гневно

    И що трябва да вярваме на тая никому неизвестна кака, а не на десетките публкации, които твърдят точно обратното? Рекламна статийка за ваксините и нищо повече. А за тях, ваксините, всеки трябва да си решава сам. До гуша ми дойде от неспирните спорове между ваксъри и антиваксъри.

    "Шумът нищо не доказва. Кокошката, снесла яйце, понякога кудкудяка толкова силно, като че ли е снесла малка планета"- Марк Твен
  35. 35 Профил на Vαζελιν Αλbιωνοβ
    Vαζελιν Αλbιωνοβ
    Рейтинг: 295 Весело

    До коментар [#31] от "uq":

    Ше верваш на който ти кажат да верваш, вервай ми!

    кравосмешението прави зелката ^¥^
  36. 36 Профил на Хелиана
    Рейтинг: 1507 Неутрално

    Тотален потрес от писаниците в статията. Да тръгнат да убеждават народа, че за една година сътвориха чудо невиждано, което е значително по-добро от създаденото за милиони години от природата. Просто но комент. Да не говорим за смехотворното 4% с имунитет. Ако напиша какво мисля за твърдящите подобни кретенизми ще ме баннат. Затова ..............

  37. 37 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#34] от "Умнокрасив гербераст от Позитано":

    > А за тях, ваксините, всеки трябва да си решава сам.


    >До гуша ми дойде от неспирните спорове между ваксъри и антиваксъри.

    Май спорът е само когато едните настояват другите да се набоцкат собственоръчно или да им бъде забранено да излизат от мазетата.

    За което не намирам логическо обяснение, защото нали се предполага че ако ваксинираш себе си и вече си спасен ? Какво значение има ако някой антиваксър излиза веднъж на три дни от мазето си, за да си купи хляб ?

  38. 38 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#36] от "Хелиана":

    > Затова ............

    Затова излезте навън пийте едно капучино или джин с тоник и се наслаждавайте на живота.

    Живота е хубав.

    Пък ако/като му дойде времето, ще мислим какво да правим с тия експерти.

  39. 39 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#36] от "Хелиана":

    > Затова ............

    Затова излезте навън пийте едно капучино или джин с тоник и се наслаждавайте на живота.

    Живота е хубав.

    Пък ако/като му дойде времето, ще мислим какво да правим с тия експерти.

  40. 40 Профил на mavro
    Рейтинг: 440 Неутрално

    До коментар [#4] от "Petio Petkov":

    В моя по-широк приятелски кръг от 30 преболедували има 3-4 регистрирани.

  41. 41 Профил на Умнокрасив гербераст от Позитано
    Умнокрасив гербераст от Позитано
    Рейтинг: 914 Неутрално

    До коментар [#37] от "Ан Он":

    Двете групи реално не си пречат и споровете им са идиотски. Едните не би трябвало да са застрашени щом са ваксинирани. На другите не им влиза в работата, какви биха били евентуални последствия от ваксините, след като така или иначе не смятат да се ваксинират.

    "Шумът нищо не доказва. Кокошката, снесла яйце, понякога кудкудяка толкова силно, като че ли е снесла малка планета"- Марк Твен
  42. 42 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#41] от "Умнокрасив гербераст от Позитано":

    Абсолютно съгласен.

    Даже преди седмица бях предложил да разделим територията на два резервата, всеки да си избира в кой от двата да се обитава, и оттам нататък всички да живеят в мир и разбирателство и душевен комфорт.

    Пък ако населението на единия резерват си замине по някакви причини, населението на другия резерват ще може да си разшири хабитата.

  43. 43 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#41] от "Умнокрасив гербераст от Позитано":

    > Двете групи реално не си пречат

    Все пак да отбележим че има известна асиметрия.

    Поне едната от групите иска да наложи ограничения на лицата от другата група, тъй като не са от правилната група.

    Затова два резервата е най-добре.

  44. 44 Профил на faraon
    Рейтинг: 579 Неутрално

    230 000 са официално преболедувалите. Към тях трябва да се прибавят безсимптомно преболедувалите - 50%, според научни публикации, преболедувалите и нерегистрирани с леки и средно тежки симптоми в къщи (в моето семейство са 8-9 при само 1 регистриран), преболедувалите по селца и паланки, без достъп до нормална медицинска помощ, страхуващите се да влязат в болница - и те не са малко. Общо според наши епидемиолози, включително от НОЩ, преболедувалите са от 1,5 до 2,5 милиона при 5-5,2 милиона души в държавата (без емигрантите). От тази цифра трябва да се тръгва, за да има смисъл от анализа. С погрешни данни и най-добрият експерт няма да направи точни изводи.
    —цитат от коментар 4 на Petio Petkov

    Тези с настинка или с друго вирусно заболяване трябва да бъдат изключени. Вероятно преминалите през К19 са не повече от 500 000.

  45. 45 Профил на kukuf
    Рейтинг: 433 Неутрално

    До коментар [#10] от "Ан Он":

    Ами аз,като прост доктор си мисля,че "пациент с леки или никакви симптоми"има толкова добра имунна система,която въобще не допуска коронката по-навътре от носоглътката,трепе си го там намясто и въобще не се стига до общо заболяване.Също така си мисля,че един толкова фино регулиран и абсолютно адекватен за организма имунен отговор направо си е грехота да бъде изнасилван...

  46. 46 Профил на fpyyh
    Рейтинг: 2139 Неутрално

    Не можете да вкарвате всички изкарали го в графата защитени, нас с жена ми ни повтори. Имахме положителен PCR почти без симптоми есента, в края на януари го хванахме и двамата (от нейния офис, аз се опазих седмица у нас, но ме докопа), този път със симптоми - загуба на обоняние, температура. Кой ще каже колко от уж потенциално 2-та милиона "защитени" по бакалските сметки ще го изкарат пак? Нищо специално няма у нас, че да не може да се случи и на други.

    за да разберете всичко за белодробния рак, продължавайте да пушите
  47. 47 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#45] от "kukuf":

    Моите уважения за коментара, сложих плюсче (не че е важно).

    Все още ме човърка въпроса как примерно аз, ако "нямам никакви симптоми", някой друг преценява дали "съм пациент" или "не съм пациент"... Но не е важно.

  48. 48 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#46] от "fpyyh":

    > Имахме положителен PCR

    Това всъщност не значи нищо.

    А иначе - отдавна всички сме Заразени, въпрос е на концентрация и реакция на организма (имунната система).

    Пожелавам здраве и дълъг живот.

  49. 49 Профил на Славейко
    Рейтинг: 302 Неутрално

    Само че тази цифра е изключително неточна! А и Чорбанов каза - нищо не се говори за Т клетъчен имунитет, а Мангъров добави - те и не знаят за него, защото не са го учили като са учили.

  50. 50 Профил на dosetliv
    Рейтинг: 1521 Неутрално

    И изобщо - какво значи 'пациент с леки или никакви симптоми' ? Какво му е пациентското ?
    —цитат от коментар 10 на Ан Он

    Щом пецерето по метода на др Дростен е светнало на 45 цикъла значи е пациент без симптоми и точка.

    Има и учЕни, които за разлика от др Великова се задълбочават повече. От изследването на клуб Тромпета в Берлин научаваме:

    - още преди година време са били известни 108 чешита ковиди
    - за заразен се брои който светва до 25 цикъла (значи че има много вирус къде шава)
    - повече цикли се правят само на дали положителен тест за антитела (значи че вече са преболедували, вирусът е утрепан и се търсят остатъци от него за статистически цели)
    - пецерето треба да мери по зададен пълен геном на вируса , а не по парче от него както се прави в масовката

    Резултатът е че в 17 проби е намерен италиански ковид (4 не пасват баш, ама са пуснати компромисно) . Останалите са с некакви други вируси , един примерно излиза като CAACTTTCGATCTCTTGTAGATCTG , друг като GTACAGAAATTGACCCTAAGTTGGACA - оди ги разбери

    Прочее самият матрял отпочва с груба логическа грешка

    Едва за около 4% от населението на България може да се смята, че има имунитет
    —цитат от коментар 0 на матряла

    Точно обратното е - щом 4% се се разболяли значи че са нямали имунитет, а останалите 96% неразболяни са имали.

  51. 51

    Коментарът беше изтрит от модераторите, защото съдържаше обидни или нецензурни квалификации, обиди на расова, сексуална, етническа или верска основа или призиви към насилие по адрес на конкретни лица.

  52. 52

    Коментарът беше изтрит от модераторите, защото съдържаше обидни или нецензурни квалификации, обиди на расова, сексуална, етническа или верска основа или призиви към насилие по адрес на конкретни лица.

  53. 53 Профил на victor_victim
    Рейтинг: 543 Неутрално

    До коментар [#45] от "kukuf":

    Колко сте лекар, само вие си знаете. Ако допуснем, че е вярно, то очевидно имате пропуски в обучението. Има множество описани случаи на повторно и ТЕЖКО боледуване, вкл. и в България. Трябва да прочетете по-задълбочено протичането на двете фази на болестта. Това, че първият път, вирусът "се е спрял в носоглътката" ВЪОБЩЕ НЕ ОЗНАЧАВА, ЧЕ ПРИ ПОВТОРНА СРЕЩА НЯМА ДА СПРЕ В ДОЛНИТЕ ОТДЕЛИ НА ДИХАТЕЛНАТА СИСТЕМА!!! Защо ли?? Ще го обясня като за селско джи-пи - защото за прикрепването отговарят различни АГ, съответно се изискват и различни АТ!!

  54. 54 Профил на gaden_no_chesten
    Рейтинг: 272 Неутрално

    Бла, бла ,бла.. вкасини, бла бла бла - промиване на стадото короноиди- това е тая статия. Погнусенсъм от това как платен медицински слугинаж ръси лъжи по цял ден само и само да се прообутат вакс ментетата. Днес короноидите ликуват - дойде поредния камион с вкасите и ще се бодат на воля. А нормалните хора, които изкарахме китайския сопол на крак , че даже тренирайки днесизлизамен навън да се поспортуваме и да се насладим на хубавоот време. Това е здравето - всичко друго е заблудда и протяжен вой на насрани то страх короноиди, заврели се по дупките си и злобеещи срещу смелите и нормални хора, които си живеят живота. На такива клетници и 10 ваксини да им набият не могат да ги спасят :-)

  55. 55 Профил на Мусаши
    Рейтинг: 1847 Неутрално

    До коментар [#31] от "uq":Колега, това че вашия организъм има някакви особености... са си особености на вашия организъм.Трябва да имаме доверие на Науката. Само тя може да ни Спаси в тези Смутни Времена.
    —цитат от коментар 32 на Ан Он

    Като гледам каква висока смъртност има от Ковид и то в най-развитите държави по света,не ми се вижда много адекватна тая сляпа вяра в науката. Т.е наистина в науката е решението на проблемите, ама явно съвременната наука върви в грешна посока.

  56. 56 Профил на inn
    Рейтинг: 1552 Неутрално

    В спора кой е "по-по-най" не знам защо трабва да има един, който е само прав, и един, който е само крив. Ами няма по принцип прав и по принцип крив, има показатели, по които единият вариант - естествен имунитет - е по-добър, има други показатели, по които другият вариант - ваксина - е по-добър. С ваксината какво правим - всъщност наподобяваме природата с помощта на човешкия ум и умения - да създадем заместител на естествения вирус, като заместителят да ни бъде полезен. Същото е като с опитомяването на дивите животни. Ясно е, че това много ни е помогнало (още от Каин и Авел, скотовъдецът е любимец на Бога), обаче пусто - домашното животно не може да се оправя в жимата природа, както дивият си събрат. Това пък не значи, че трябва да се откажем от изкуственото развъждане на живи организми (печеното пиле на трапезата си е вкусно - е, покрай това ще глътнем и малко хормони на растежа, което пък няма да ни събори - никой няма да живее с орлите...).
    Та така и с ваксините - колкото по-добри сме в наподобяването на живата природа, толкова повече плюсове и по-малко минуси ще си набавяме. Но НИКОГА няма да станем толкова добри, колкото Създателя....

  57. 57 Профил на victor_victim
    Рейтинг: 543 Неутрално

    До коментар [#55] от "Мусаши":

    Какъв пропуск за човечеството, че не сте живели и при създаването на останалите ваксини, благодарение на които сме оцеляли. Със сигурност щяхте да посочите правилната посока на науката! хахах

  58. 58 Профил на ART
    Рейтинг: 279 Неутрално

    Много ми е интересна логиката тук. Значи леко преболедувалите трябвало да се ваксинират, защото имали по-малко антитела. Само се забравя, че тия хора просто нямат нужда от антитела. Те имат вградена защита. Техните организми се справят отлично и без ваксина. Има хора, които дори на разбират, че са преболедували.

    Моята вяра в медицинската наука започна силно да се разклаща. Изказаха се де що има професор и доцент и всеки дрънка врели-некипели облечени в научна терминология, и точно противоположни на другия с многото титли.

    Всъщност отдавна се спори дали медицината е наука. Много авторитетни представители на медицинската общност са съгласни, че медицината не е наука. И аз им вярвам.

  59. 59 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#53] от "victor_victim":

    > Има множество описани случаи на повторно и ТЕЖКО боледуване

    Колега, това е Вирус, не е Хипопотам.

    Разликата че Хипопотам те прегазва еднократно, а Вирусът е навсякъде наоколо.

    Всички сме Заразени. В зависимост от съпротивителните сили на организма в възможно в даден момент да избие в някаква посока. Или никога да не избие защото имунната система си работи както е по дизайн и го неутрализира достатъчно качествено.

    Реално всички сме 'болни' в различна степен от корона вирус през цялото време.

  60. 60 Профил на primumnonnocere
    Рейтинг: 37 Любопитно

    "останалите 10% които могат да мислят знаят, че ваксините работят за намаляване на ефекта от заразата а не от премахването и... ама хора всякакви"
    До коментар [#26] от "padrino":

    Вие предполагам се самоопределяте в тези 10%.

    Затова ще ви помоля да споделите приблизителният брой на леките и по-тежки случаи на туберкулоза, шарка и всевъзможните други болести, за които човек е ваксиниран от дете, от вас и вашето семейство до момента.
    Приблизителен брой само, няма нужда от точни детайли.

    И ако не може да си спомните за такива случаи, не означава ли това, че има ваксини, с които човек се ваксинира веднъж и те предпазват да се разболееш цял живот.
    И че има мошенгии, използуващи същата дума "ваксина", продукт на фарма-мафията, които само уж "намаляват ефекта на заразата" - обикновено използувани срещу болести, които типично се появяват през зимата, когато имунната система на огромната част от населението е отслабена, вследствие на хроничен недостиг на витамин Д например

    За мислещите - не ви ли хрумва, че тези мошенгии може да се елиминират и защитата на населението да се води по друг начин - чрез раздаване на безплатни витамини на децата в детските градини и училищата, и чрез публични къмпании в медиите, насочени към останалата част от населението.

  61. 61 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#58] от "ART":

    > Моята вяра в медицинската наука започна силно да се разклаща.

    Това дето го дърдорят последната година по телевизорите няма много общо ни с медицина, ни с наука.

    Има си и хора които се занимават с наука и медицина, ама тях не ги виждаме ежедневно да бръщолевят.

    Като съвсем пресен пример - съпоставете изявленията на директора на Пирогов който се прожектира всеки ден с интервюто на шефа на КОВИД клиниката в Пирогов.

  62. 62 Профил на Мусаши
    Рейтинг: 1847 Неутрално

    До коментар [#55] от "Мусаши":Какъв пропуск за човечеството, че не сте живели и при създаването на останалите ваксини, благодарение на които сме оцеляли. Със сигурност щяхте да посочите правилната посока на науката! хахах
    —цитат от коментар 57 на victor_victim

    Естествено. Хомо сапиенс е на 200 хиляди години. А хуманоидите са на 7 милиона години.Ваксини има от 150 години. Как ли са оцелели хората 200 хиляди години и предците им 7 милиона години без ваксини?

  63. 63 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#58] от "ART":

    Доц. д-р Петър Атанасов, завеждащ COVID отделението на УМБАЛСМ "Пирогов", пред Капитал


    И пак се нагнетява страх - сега с "новите щамове" - няма нов щам. Има вариации на познатия ни щам и тези вариации не са "по-заразни, по-болестотворни", слава Богу не са "истинските убийци", каквито се стараят да ги издокарат. Не разбирам защо се прави всичко това?! И ми се иска да подчертая, че нагнетяването на страх, което и в момента се случва, е заговор срещу всички нас. Иска ми се да помоля всички истински журналисти да не участват в това престъпно деяние.

  64. 64 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#55] от "Мусаши":

    > Т.е наистина в науката е решението на проблемите, ама явно съвременната наука върви в грешна посока.

    Е това дето ни прожектират по медиите и сайтовете не е баш наука.

    Все някога ще дойде времето и на истинските специалисти.

  65. 65 Профил на enter_k
    Рейтинг: 1605 Неутрално

    До коментар [#37] от "Ан Он":

    След установеното, че ваксинирони и неваксинирани могат да се заразят и си остават еднакво потенциални преносители на заразата, неизвестен е и периода на устойчивост на антителата на двете групи то логиката в мотивираното налагане на ваксиниране сведено до едно маркиране на част от населението се размива до изясняване в близките 5г.

  66. 66 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#57] от "victor_victim":

    > при създаването на останалите ваксини, благодарение на които сме оцеляли

    Медицина и наука е едно. Политика, медийна пропаганда и бизнес интереси е друго.

    Ей ви едно филмче за близкото минало:

    You Won't Believe What They Admitted on the News in 1971...

  67. 67 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#57] от "victor_victim":

    Ей ви и друг пример за издънка на фармацевтичната индустрия:


  68. 68 Профил на Мусаши
    Рейтинг: 1847 Неутрално

    До коментар [#55] от "Мусаши":> Т.е наистина в науката е решението на проблемите, ама явно съвременната наука върви в грешна посока.Е това дето ни прожектират по медиите и сайтовете не е баш наука.Все някога ще дойде времето и на истинските специалисти.
    —цитат от коментар 64 на Ан Он

    Съвременната медицина е огромна машина за пари.Човешкият организъм има уникални способности за самолечение.Но ако тръгне науката да се развива в тази посока фармацевтичната мафия отива на кино.Така че не очаквам нещо по-различно от досега.

  69. 69 Профил на Nikola Slavov
    Nikola Slavov
    Рейтинг: 242 Неутрално

    quote#24: "Народ, който очаква комунисти, чалгари и болшевики да го избавят от тежкото пожарникарско робство е обречен."

    Не моье да има по комунистическо, чалгарско и болшевишко робство от пожарникарското.

  70. 70 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#68] от "Мусаши":

    Според мен малко смесвате термините (точните думички), но няма да придирям.

    Като цяло съм съгласен, това което ни прожектират е бизнес, не грижа за хората.

  71. 71 Профил на Храбър
    Рейтинг: 3513 Неутрално

    До коментар [#2] от "hamiltonf":

    Препоръчвам ти да прочетеш внимателно цялата статия.
    Не се разбира на къде биеш.
    Аз останах с впечатлението, че при заразяването на даден организъм, природата действа по-бавно, но по-сигурно. Природата си е изработила метод на защита, който се развива и достига по-качествен отговор, но доста по-бавно. В своя вечен стремеж да постигне по-скоростна реакция, човекът прескача някои фази, взима информация от средата на процеса (ако може така да се каже) прилага я и успява....но само в по-ограниен размер и по-некачествено.

    "Безнаказаността на похищенията и произволното разполагане с притежанията на повалените стари имуществени прослойки след 9-ти септември има като пряко следствие създадената и поддържана политическа обстановка за корупция"
  72. 72 Профил на hamiltonf
    Рейтинг: 3897 Неутрално

    До коментар [#71] от "Храбър":

    Които трябва са разбрали, и достатъчно ясно е написано за какво става дума, който може да чете по-внимателно, де...

    Старши подофицер Сава Геров, Първа пехотна софийска дивизия, герой, за когото се знае твърде малко... Вечна му памет!
  73. 73 Профил на hope
    Рейтинг: 2910 Неутрално


    14в. в Европа измира 1/3 от населението от чума. И сега ще оцелеем без ваксини, въпросът е колко от нас...

    Любовта ще спаси света!!!
  74. 74 Профил на hope
    Рейтинг: 2910 Неутрално

    До коментар [#68] от "Мусаши":

    “Съвременната медицина е огромна машина за пари.Човешкият организъм има уникални способности за самолечение.Но ако тръгне науката да се развива в тази посока фармацевтичната мафия отива на кино.Така че не очаквам нещо по-различно от досега.”

    Точно така, организмът ни може да се излекува от почти всичко, сам. Изключваме агресивните вируси, гъби, бактерии и паразити.

    Любовта ще спаси света!!!
  75. 75 Профил на hope
    Рейтинг: 2910 Неутрално

    Очаквам заведенията да заявят, дали персоналът им е ваксиниран, иначе ще чакаме лятото. Сервитьорите носят маските на брадичката, миналата седмица един само дето не ме наплю, за да надвика уредбата.

    Любовта ще спаси света!!!
  76. 76 Профил на Мусаши
    Рейтинг: 1847 Неутрално

    До коментар [#68] от "Мусаши":“Съвременната медицина е огромна машина за пари.Човешкият организъм има уникални способности за самолечение.Но ако тръгне науката да се развива в тази посока фармацевтичната мафия отива на кино.Така че не очаквам нещо по-различно от досега.”Точно така, организмът ни може да се излекува от почти всичко, сам. Изключваме агресивните вируси, гъби, бактерии и паразити.
    —цитат от коментар 74 на hope

    Напротив-и от вируси и вредни бактерии може сам да се излекува организма.Стига човек да знае как да задейства механизма за самолечение.Аз например Ковид го преодолях за 3-4 дни без никакви лекарства.И бях диагностициран с ПСР тест,а не съм си самопоставил тази диагноза.

  77. 77 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#74] от "hope":

    > Изключваме агресивните вируси, гъби, бактерии и паразити.

    И хипопотами.

    Само в Африка умират по 500 човека на година от хипопотами.

    >Ungainly as it is, the hippopotamus is the world's deadliest large land mammal, killing an estimated 500 people per year in Africa.

  78. 78 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#74] от "hope":

    > Точно така, организмът ни може да се излекува от почти всичко, сам.
    > Изключваме агресивните вируси, гъби, бактерии и паразити.

    Кокосовите орехи също са напаст, дори Снуупс не са успели да оборят твърдението че повече хора са си заминали от удар от кокосов орех, отколкото са били изядени от акула:


  79. 79 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално

    До коментар [#76] от "Мусаши":

    > Стига човек да знае как да задейства механизма за самолечение.
    > Аз например Ковид го преодолях за 3-4 дни без никакви лекарства

    Първо глад ? После ?

  80. 80 Профил на 911
    Рейтинг: 686 Неутрално

    "Според нея ваксинирането е начин наведнъж голяма част от населението да стане невъзприемчиво към заразата и това да блокира разпространението ѝ."
    - наведнъж до към 2040 г.

    Добре че е БЦЖ и че тя не е доставяна и поставяна от "перфектната организация" на "перфектния премиер".

    203 хил. регистрирани + 8 до 25 пъти повече нерегистрирани (според оценките на математика на НОЩ - поне 8 пъти; според други оценки за други популации - около и над 25 пъти) преминали ковид. Сметката е доста различна май...

  81. 81 Профил на 911
    Рейтинг: 686 Неутрално

    Сега целта е "перфектният премиер" да саботира изборите и да каже - "Радев е виновен, подходи безотговорно и назначи изборите посред пандемия, вместо да изчака... " (2-3 години - след толкова калинките ще са се насмукали, налетели и охотно ще излязат в пенсия... ама не като нашите, от фонда на НОИ, а от едни други "бели пари за черни дни.. спестени от заплата и дарени от родителите им")

  82. 82 Профил на redlight
    Рейтинг: 52 Весело

    Ама тя докторката "смятала", мислела, разсъждавала, следователно съществувала и на тези нейни и на колегите й "смятания" разчита обществото да се информира.
    То пък от своя страна "смята", че щом е д-р, генерал, професор, инженер, светило на медицината у нас трябва да подхождаме с рогите напред.

  83. 83 Профил на Хелиана
    Рейтинг: 1507 Неутрално

    До коментар [#79] от "Ан Он":

    Известно време сурови плодове и зеленчуци.

  84. 84 Профил на Nik Nikolov
    Nik Nikolov
    Рейтинг: 217 Неутрално

    Даже най- сигурно е и ембриона да се боцне, още на месец два и да го бодат, ч е ше заразява бабите един ден като се роди...ви еа мам та фашистка.

  85. 85 Профил на hope
    Рейтинг: 2910 Неутрално

    До коментар [#76] от "Мусаши":

    Хубаво, обаче има хора със съпътстващи заболявания, с отслабен имунитет.

    Любовта ще спаси света!!!
  86. 86 Профил на AModoMio
    Рейтинг: 3061 Неутрално

    Една държава прави да замълчат всички: така че Сърбия има всички ваксини


    "Ако ние нямахме взаимоотношения с политиците щяхме да бъдем една банда от чакали. Или една обикновена банда и щяхме да бъдем анулирани." Тото Риина след атентатите
  87. 87 Профил на keen
    Рейтинг: 1073 Неутрално

    "наведнъж голяма част от населението"

    - Виждаме колко е "наведнъж". С тоя темп на ваксиниране, това "наведнъж" ще се разтегне в няколко години...

    Където и да натиснеш в ГЕРБ, излиза ГНОЙ.
  88. 88 Профил на alexsilver
    Рейтинг: 992 Неутрално

    "...два за около 4% от населението на България може да се смята, че има имунитет срещу COVID-19. Резултатът се получава като към преболедувалите от началото на епидемията (около 203 хил. души) се прибавят ваксинираните с втора доза (около 35 хил. души)..."

    МанипулациЙ му е майката. Нито ден без манипулациЙ. ТАЯ "специалистка" нито е чула, нито чела, че освен официално регистрираните "заразени", болни демек, нерегистрираните са около 10 пъти повече. И второто нещо за отбелязване е, че нито е учила, нито разбрала основните постулати на вирусологията, която не е създадена вчера от група джендъри, а е натрупала вековен опит. Най-добрата имунизация е точно след преболедуване на инфекцията и тя се базира не само на антитела, а и на клетъчния имунитет.
    Но откато "едни мъже" с обратна резба ги признаха за нормалните, а другите за сбъркани, евем ти и днешната продажна медицина. Ще въртят ъ&за като "ентелегенция", само и само да оцелеят и се нагушат.
    А от ваксините Бил се похвали, че се печели 2000%. Чудно ли е, че и Рашата се готви да гушне над $200 ярда от ваксини? Въпреки старанието на "лоялната" конкуренция без спир да ги облива с фекални води?

  89. 89 Профил на Мусаши
    Рейтинг: 1847 Неутрално

    До коментар [#76] от "Мусаши":> Стига човек да знае как да задейства механизма за самолечение.> Аз например Ковид го преодолях за 3-4 дни без никакви лекарстваПърво глад ? После ?
    —цитат от коментар 79 на Ан Он

    Само глад. 4 дни не ядох и не пих вода.И на четвъртия ден нямах никакви симптоми. Естествено аз имам голям опит с гладуването ,ама дори и 2 дни до се издържи пак има огромна полза. Гладът убива всички вируси.

  90. 90 Профил на Крадливото ромче
    Крадливото ромче
    Рейтинг: 2371 Неутрално

    Ако не бяха измислили ваксината срещу едра шарка, колко ли щяха да придобият естествен имунитет?????

    Комунистите са виновни!
  91. 91 Профил на Храбър
    Рейтинг: 3513 Неутрално

    ... Стига човек да знае как да задейства механизма за самолечение.> Аз например Ковид го преодолях за 3-4 дни без никакви лекарстваПърво глад ? После ?
    —цитат от коментар 79 на Ан Он

    А така!
    Глад и бой.
    Това е рецептата срещу Ковид.
    После четох, че трябвало да се пие и студена вода направо от хладилника.

    "Безнаказаността на похищенията и произволното разполагане с притежанията на повалените стари имуществени прослойки след 9-ти септември има като пряко следствие създадената и поддържана политическа обстановка за корупция"
  92. 92 Профил на Храбър
    Рейтинг: 3513 Неутрално

    Гладът убива всички вируси.
    —цитат от коментар 89 на Мусаши

    Ми то гладът убива не само вирусите.....
    Бе кой превари....

    "Безнаказаността на похищенията и произволното разполагане с притежанията на повалените стари имуществени прослойки след 9-ти септември има като пряко следствие създадената и поддържана политическа обстановка за корупция"
  93. 93 Профил на alexsilver
    Рейтинг: 992 Неутрално

    "...Едва за около 4% от населението на България може да се смята, че има имунитет срещу COVID-19..."

    Може пък и да е права. SARS-Cov-2 отдавна го няма. Заместиха го други коронавируси с подобно действие. Доста съмнително е да се смята, че ваксините са универсални за предотвратяване на заболяване. Но наистина са универсални за Търговските дружества, които по цял свят са в основата на т.н. здравеопазване, където стоката е здраве и живот или болест и смърт. Справка, антигрипните ваксини, които някак си винаги "умерват" точния вид на "идващия" грип.

  94. 94 Профил на cormoranstrike
    Рейтинг: 570 Неутрално

    До коментар [#90] от "Крадливото ромче":

    Колега, а каква е смъртността при шарката и при този ковида? Не сравнявайте несравними неща! Въобще не съм антиваксър, но цялата пропганда и откровено фашистките гласове, които се чуват, никак не допринасят за убеждаването в ползата от ваксините срещу Sars-Cov2

  95. 95 Профил на cormoranstrike
    Рейтинг: 570 Неутрално

    До коментар [#44] от "faraon":

    Каква настинка ви гони - по седмица-две с висока температура и загуба на обоняние? От приятели, роднини и колеги по е 40 човека го минахме с тези симптоми. От тях 3-4 са в статистиката.

  96. 96 Профил на Ан Он
    Ан Он
    Рейтинг: 2758 Неутрално


    > А така!
    > Глад и бой.

    Глад, бой и сръбска музика май е класическата рецепта ?

  97. 97 Профил на t5eyes
    Рейтинг: 662 Неутрално

    Стотици хиляди Българи го преболедуваха без симптоми или на домашно лечение по рецепта (вкл аз) без тестове

    свят, спри да се кланяш на богинята Кали
  98. 98 Профил на Мусаши
    Рейтинг: 1847 Неутрално


    Ами ти по ги разбираш явно нещата.Остава и да кажеш на близките на 10-е хиляди загинали,че са получили адекватно лечение.

  99. 99 Профил на kukuf
    Рейтинг: 433 Неутрално

    До коментар [#53] от "victor_victim":

    Този урок,който трябва да прочетем,се пише в момента!Лошото в ситуацията е,че се дава гласност или на супер специализирани да речем в имунологията лекари,които нямат кой знае какъв опит в практиката,или пък на колеги,които работят САМО с тежко протичащи случаи в болнични условия,реанимации и спешни отделения.Трябва според мен,да има и някакъв що-годе обективен глас/да речем на селско джи пи/.Има ли коронавирус?-Има!Колко е чест?Доказани около 10 %случая от пациентската листа.С други думи всеки се е срещал по някакъв начин с причинителя.Колко е смъртоносен-ами няма починали от доказаните ми около 300 пациенти.Има ли тежко протичащи случаи?Има!Има и ясно изразена фамилност на тежко протичащите случаи/най-вече бащи-синове или обратното/.Има ли ваксини-вече да!Кой да се ваксинира?-В момента този,на когото му трябва серификат.Сегашната вълна по естествен/и не само / начин ще спадне за летния сезон.Наесен бих ваксинирал рискови според мен пациенти.Ми това е.Бъди здрав!

  100. 100 Профил на cormoranstrike
    Рейтинг: 570 Неутрално

    До коментар [#99] от "kukuf":

    Най-сетне един нормален глас!

За да коментирате, е нужно да влезете в профила си или да се регистрирате.
С използването на сайта вие приемате, че използваме „бисквитки" за подобряване на преживяването, персонализиране на съдържанието и рекламите, и анализиране на трафика. Вижте нашата политика за бисквитките и декларацията за поверителност. ОK